logo

logo

Alignment Sekuens DNA Secara Online


Jika pada postingan sebelumnya saya membahas pengertian alignment [silakan baca di sini], maka pada kesempatan kali ini saya akan memberi tutorial untuk meng-alignment suatu sekuens. Pada tutorial ini saya memberikan contoh cara sekuens DNA melalui situs EBI (European Bioinformatics Institute) sementara untuk alignment dengan menggunakan program seperti MEGA 4 dan PFE dapat dibaca di sini [Klik]

Baiklah kita akan belajar meng-aligment sekuens DNA yang sebelumnya silakan diambil dari GenBank (NCBI) dengan syarat jenis gen yang digunakan adalah sama, misal gen cyt b, ITS, kloroplas, dan lain-lain. Sebagai contoh saya menggunakan berbagai gen cyt b pada sub-spesies harimau (Panthera tigris) dengan accession number FJ465511.1; FJ465508.1; JF357971.1; JF357969.1; JF357973.1; FJ469625.2; dan JQ904290.1. Jika anda masih kesulitan untuk mencari gen di NCBI maka silkan copy gen yang berwarna biru berikut ini:

>Panthera_tigris_tigris_2
CTATGGTTTTACCCTGCTTGTGAGCCTGTATTTACATGATAATACTTAATGACCCACCAAACCCACGCAT
ATCACATGGTTAATCCCAGCCCATGGCCACTTACAGGGGCCCTTTCGGCCCTACTAATAACCTCAGGCCT
GGCTATATGATTTCACTATAACTCAATACTACTATTAACTCTAGGAATAACCACTAACCTATTGACTATA
TACCAATGGTGACGAGACATCATTCGGGAGAGCACATTCCAAGGCCACCACACACCCATTGTTCAAAAAG
GCCTCCGATACGGAATAATCCTTTTCATCATCTCAGAAGTATTCTTCTTCGCAGGTTTTTTCTGGGCCTT
CTATCACTCAAGCCTGGCCCCGACCCCCGAATTGGGAGGATGCTGGCCACCAACAGGTATTATTCCCCTA
AACCCCCTAGAAGTCCCACTACTCAATACTTCTGTGCTCTTAGCTTCCGGAGTGTCAATCACCTGAGCCC
ATCATAGCCTAATAGAAGGAAATCGAAAACACATGCTCCAAGCACTATTTATTACAATCTCCCTAGGAGT
CTATTTTACCCTCCTCCAAGCCTCTGAGTACTATGAAACATCATTTACAATCTCGGACGGAGTTTATGGG
TCCACCTTTTTCATAGCCACAGGGTTCCACGGACTACACGTAATTATTGGCTCTACCTTCCTAATCGTAT
GTTTCTTGCGCCAACTAAAATACCACTTCACATCGAGCCACCATTTTGGATTCGAAGCCGCTGCTTGATA
TTGACACTTCGTAGACGTAG
>Panthera_tigris_tigris_1
CTATGTTTTTACCCTGCTTGTGAGCCTGTATTTACATGATAATACTTAATGACCCACCAAACCCACGCAT
ATCACATGGTTAATCCCAGCCCATGGCCACTTACAGGGGCCCTTTCGGCCCTACTAATAACCTCAGGCCT
GGCTATATGATTTCACTATAACTCAATACTACTATTAACTCTAGGAATAACCACTAACCTATTGACTATA
TACCAATGGTGACGAGACATCATTCGGGAGAGCACATTCCAAGGCCACCACACACCCATTGTTCAAAAAG
GCCTCCGATACGGAATAATCCTTTTCATCATCTCAGAAGTATTCTTCTTCGCAGGTTTTTTCTGGGCCTT
CTATCACTCAAGCCTGGCCCCGACCCCCGAATTGGGAGGATGCTGGCCACCAACAGGTATTATTCCCCTA
AACCCCCTAGAAGTCCCACTACTCAATACTTCTGTGCTCTTAGCTTCCGGAGTGTCAATCACCTGAGCCC
ATCATAGCCTAATAGAAGGAAATCGAAAACACATGCTCCAAGCACTATTTATTACAATCTCCCTAGGAGT
CTATTTTACCCTCCTCCAAGCCTCTGAGTACTATGAAACATCATTTACAATCTCGGACGGAGTTTATGGG
TCCACCTTTTTCATAGCCACAGGGTTCCACGGACTACACGTAATTATTGGCTCTACCTTCCTAATCGTAT
GTTTCTTGCGCCAACTAAAATACCACTTCACATCGAGCCACCATTTTGGATTCGAAGCCGCTGCTTGATA
TTGACACTTCGTAGACGTAG
>Panthera_tigris_corbetti
ATGACCCACCAAACCCACGCATATCACATGGTTAATCCCAGCCCATGGCCACTTACAGGGGCCCTTTCGG
CCCTACTAATAACCTCAGGCCTGGCTATATGATTTCACTATAACTCAATACTACTATTAACTCTAGGAAT
AACCACTAACCTATTGACTATATACCAATGGTGACGAGACATCATTCGGGAGAGCACATTCCAAGGCCAC
CACACACCCATTGTTCAAAAAGGCCTCCGATACGGAATAATCCTTTTCATCATCTCAGAAGTATTCTTCT
TCGCAGGTTTTTTCTGGGCCTTCTATCACTCAAGCCTGGCCCCGACCCCCGAATTGGGAGGATGCTGGCC
ACCAACAGGTATTATTCCCCTAAACCCCCTAGAAGTCCCACTACTCAATACTTCTGTGCTCTTAGCTTCC
GGAGTGTCAATCACCTGAGCCCATCATAGCCTAATAGAAGGAAATCGAAAACACATGCTCCAAGCACTAT
TTATTACAATCTCCCTAGGAGTCTATTTTACCCTCCTCCAAGCCTCTGAGTACTATGAAACATCATTTAC
AATCTCGGACGGAGTTTATGGGTCCACCTTTTTCATAGCCACAGGGTTCCACGGACTACACGTAATTATT
GGCTCTACCTTCCTAATCGTATGTTTCTTGCGCCAACTAAAATACCACTTCACATCGAGCCACCATTTTG
GATTCGAAGCCGCTGCTTGATATTGACATTTCGTAGACGTGGTTTGACTGTTCTTATACGTTTCCATTTA
TTGATGAGGATCCT
>Panthera_tigris_sumatrae
ATGACCCACCAAACCCACGCATATCACATGGTTAATCCCAGCCCATGGCCACTTACAGGGGCCCTTTCGG
CCCTACTAATAACCTCAGGCCTGGCTATATGATTTCACTATAACTCAATACTACTATTAACTCTAGGAAT
AACCACTAACCTATTGACTATATACCAATGGTGACGAGACATCATTCGGGAGAGCACATTCCAAGGCCAC
CACACACCCATTGTTCAAAAAGGCCTCCGATACGGAATAATCCTTTTCATCATCTCAGAAGTATTCTTCT
TCGCAGGTTTTTTCTGGGCCTTCTATCACTCAAGCCTGGCCCCGACCCCCGAATTGGGAGGATGCTGGCC
ACCAACAGGTATTATTCCCCTAAACCCCCTAGAAGTCCCACTACTCAACACTTCTGTGCTCTTAGCTTCC
GGAGTGTCAATCACCTGAGCCCATCATAGCCTAATAGAAGGAAATCGAAAACACATGCTCCAAGCACTAT
TTATTACAATCTCCCTAGGAGTCTATTTTACCCTCCTCCAAGCCTCTGAGTATTATGAAACATCATTTAC
AATCTCGGACGGAGTTTATGGGTCCACCTTTTTCATAGCCACAGGGTTCCACGGACTACACGTAATTATT
GGCTCTACCTTCCTAATCGTATGCTTCTTGCGCCAACTAAAATACCACTTCACATCGAGCCACCATTTTG
GATTCGAAGCCGCTGCTTGATATTGACATTTCGTAGACGTGGTTTGACTGTTCTTATACGTTTCCATTTA
TTGATGAGGATCCT
>Panthera_tigris_altaica
ATGACCCACCAAACCCACGCATATCACATGGTTAATCCCAGCCCATGGCCACTTACAGGGGCCCTTTCGG
CCCTACTAATAACCTCAGGCCTGGCTATATGATTTCACTATAACTCAATACTACTATTAACTCTAGGAAT
AACCACTAACCTATTGACTATATACCAATGGTGACGAGACATCATTCGGGAGAGCACATTCCAAGGCCAC
CACACACCCGTTGTTCAAAAAGGCCTCCGATACGGAATAATCCTTTTCATCATCTCAGAAGTATTCTTCT
TCGCAGGTTTTTTCTGGGCCTTCTATCACTCAAGCCTGGCCCCGACCCCCGAATTGGGAGGATGCTGGCC
ACCAACAGGTATTATTCCCCTAAACCCCCTAGAAGTCCCACTACTCAATACTTCTGTGCTCTTAGCTTCC
GGAGTGTCAATCACCTGAGCCCATCATAGCCTAATAGAAGGAAATCGAAAACACATGCTCCAAGCACTAT
TTATTACAATCTCCCTAGGAGTCTATTTTACCCTCCTCCAAGCCTCTGAGTACTATGAAACATCATTTAC
AATCTCGGACGGAGTTTATGGGTCCACCTTTTTCATAGCCACAGGGTTCCACGGACTACACGTAATTATT
GGCTCTACCTTCCTAATCGTATGTTTCTTGCGCCAACTAAAATACCACTTCACATCGAGCCACCATTTTG
GATTCGAAGCCGCTGCTTGATATTGACATTTCGTAGACGTGGTTTGACTGTTCTTATACGTTTCCATTTA
TTGATGAGGATCCT
>Panthera_tigris_amoyensis
ATGACCCACCAAACCCACGCATATCACATGGTTAATCCCAGCCCATGGCCACTTACAGGGGCCCTTTCGG
CCCTACTAATAACCTCAGGCCTGGCTATATGATTTCACTATAACTCAATACTACTATTAACTCTAGGAAT
AACCACTAACCTATTGACTATATACCAATGGTGACGAGACATCATTCGGGAGAGCACATTCCAAGGCCAC
CACACACCCATTGTTCAAAAAGGCCTCCGATACGGAATAATCCTTTTCATCATCTCAGAAGTATTCTTCT
TCGCAGGTTTTTTCTGGGCCTTCTATCACTCAAGCCTGGCCCCGACCCCCGAATTGGGAGGATGCTGGCC
ACCAACAGGTATTATTCCCCTAAACCCCCTAGAGGTCCCACTACTCAATACTTCTGTGCTCTTAGCTTCC
GGAGTGTCAATCACCTGAGCCCATCATAGCCTAATAGAAGGAAATCGAAAACACATGCTCCAAGCACTAT
TTATTACAATCTCCCTAGGAGTCTATTTTACCCTCCTCCAAGCCTCTGAGTACTATGAAACATCATTTAC
AATCTCGGACGGAGTTTATGGGTCCACCTTTTTCATAGCCACAGGGTTCCACGGACTACACGTAATTATT
GGCTCTACCTTCCTAATCGTATGTTTCTTGCGCCAACTAAAATACCACTTCACATCGAGCCACCATTTTG
GATTTGAAGCCGCTGCTTGATATTGACACTTCGTAGA
>Panthera_leo_persica
ATGACCCATCAAACCCACGCATACCATATGGTTAACCCCAGCCCATGACCACTTACAGGGGCTCTCTCAG
CCCTACTGATAACCTCAGGTCTGGCTATATGATTTCACTACAACTCAACATTATTATTAACCCTAGGTAT
AACCACCAACCTACTGACTATATATCAATGGTGACGAGATATTATTCGGGAAAGCACATTCCAAGGTCAC
CACACGCCTATCGTTCAAAAAGGTCTCCGTTATGGAATAGTTCTCTTTATCATCTCGGAAGTATTCTTCT
TCGCAGGCTTTTTCTGGGCCTTCTACCACTCAAGCCTGGCCCCAACCCCCGAATTAGGAGGATGCTGGCC
ACCAACAGGTATTATTCCCCTAAACCCCCTAGAAGTCCCACTGCTTAACACTTCCGTACTTTTAGCCTCC
GGAGTATCAATTACCTGAGCCCACCATAGTTTAATGGAAGGCAATCGAAAACATATACTCCAAGCACTAT
TTATTACAATCTCCCTAGGGGTCTACTTTACCCTCCTCCAAGTCTCCGAATACTATGAAACATCATTTAC
AATCTCAGACGGGGTCTATGGATCCACCTTCTTCATAGCTACAGGATTCCACGGCCTACACGTAATTATT
GGCTCTACCTTCTTAATTGTATGTTTCTTGCGCCAACTAAAATATCATTTCACATCGAGCCACCATTTTG
GATTTGAAGCCGCTGCTTGATATTGACACTTCGTAGATGTGGTTTGACTATTCCTATACGTTTCCATTTA
TTGATGAGGATCCT
>Panthera_pardus
ATGACCCATCAAACCCACGCATACCATATGGTTAACCCCAGTCCATGGCCACTTACAGGGGCCCTTTCAG
CTCTACTGATAACTTCAGGTCTGGCTATATGATTTCACCATAACTCAATATTACTATTAACCCTAGGTAT
AACCACCAACCTGCTAACTATGTATCAGTGGTGACGAGATATTATTCGGGAAAGCACATTCCAAGGCCAC
CACACGCCTATCGTTCAAAAAGGTCTCCGTTATGGAATAATTCTCTTTATCATCTCAGAAGTATTCTTCT
TCGCAGGCTTTTTCTGGGCCTTCTACCACTCAAGCCTAGCCCCAACCCCCGAGTTAGGAGGATGCTGGCC
ACCAACAGGTATTATTCCCTTAAACCCTCTAGAAGTCCCCCTGCTTAATACCTCCGTACTTTTAGCTTCC
GGAGTGTCAATCACCTGAGCCCACCATAGCTTAATGGAAGGGAACCGAAAACATATACTCCAAGCACTAT
TTATTACAATCTCCCTAGGAGTCTACTTTACCCTTCTCCAGGCCTCCGAATACTATGAAACATCATTTAC
AATCTCAGACGGAGTCTACGGATCTACCTTCTTCATAGCTACAGGATTCCACGGCCTACACGTAATTATT
GGCTCCACCTTCTTAATTGTATGCTTCTTGCGCCAACTAAAATATCACTTCACATCGAGCCATCACTTCG
GATTCGAAGCCGCTGCTTGATATTGACACTTCGTAGATGTGGTTTGACTATTCCTATACGTTTCCATTTA
TTGATGAGGATCCT
>Puma_concolor
ATGACCCACCAAACCCACGCATACCACATAGTCAACCCCAGCCCATGGCCACTTACAGGGGCCCTTTCAG
CCCTCTTAATAACCTCAGGTCTAGCCATATGATTTCACTACAATTCAACACTATTATTAACCCTTGGAAT
AACTACTAATCTATTAACAATATACCAGTGATGACGAGACATCATTCGAGAGAGTACATTCCAAGGCCAT
CATACACCCACTGTCCAAAAAGGCCTTCGATATGGAATAATCCTCTTTATCGTCTCAGAAGTATTCTTTT
TTGCAGGCTTCTTCTGGGCCTTTTACCACTCAAGTCTAGCCCCAACCCCCGAACTAGGAGGATGCTGACC
ACCAACAGGCATTATTCCCTTAAACCCCTTAGAAGTTCCACTACTTAACACTTCTGTACTTCTAGCCTCT
GGAGTATCAATCACTTGAGCCCACCATAGTTTAATAGAAGGAAACCGAAAACACATGCTCCAAGCACTAT
TTATCACAATTTCCCTAGGAGTTTACTTCACACTCCTCCAAGCCTCCGAATATTACGAAACATCATTCAC
AATCTCAGATGGGATTTATGGGTCTACCTTCTTCATGGCCACAGGATTCCACGGACTACATGTAATCATT
GGCTCCACTTTCCTAATTGTATGCTTCTTACGTCAACTAAAATATCACTTTACATCAAACCACCACTTCG
GATTCGAAGCCGCTGCTTGATATTGACATTTCGTAGACGTAGTTTGACTATTCTTATACGTTTCCATTTA
TTGATGAGGATCTT
>Felis_catus
ATGACCCACCAAACCCATGCATACCACATAGTCAACCCTAGCCCATGGCCACTTACAGGAGCCCTTTCAG
CCCTCTTAATAACCTCAGGCCTGGCTATATGATTCCACTACAACTTAACACTGCTGTTAACCCTTGGAAT
AACTACCAACTTACTAACTATATATCAATGATGACGAGACATTATCCGAGAAAGCACATTCCAAGGCCAT
CATACACCTATCGTTCAAAAAGGCCTTCGATACGGAATAATCCTCTTTATCATCTCAGAAGTATTCTTTT
TCGCAGGCTTCTTCTGGGCCTTCTACCACTCAAGCCTAGCCCCAACCCCCGAGCTAGGAGGATGCTGACC
ACCAACAGGCATTATTCCCCTGAACCCCCTGGAAGTTCCACTACTTAATACCTCCGTGCTTCTAGCCTCC
GGAGTATCAATCACCTGAGCTCACCACAGTTTGATGGAGGGAAATCGAAAACACATGCTTCAAGCACTAT
TTATTACAATCTCTTTAGGGGTCTACTTTACACTCCTCCAAGCCTCCGAATACTATGAAACATCATTCAC
GATCTCGGACGGAGTATACGGATCTACCTTCTTCATGGCCACAGGATTCCATGGGCTACATGTAATTATT
GGCTCTACTTTCCTAATTGTATGCTTCTTACGCCAATTAAAATATCACTTTACATCAAATCACCACTTCG
GATTTGAAGCCGCCGCCTGATATTGACACTTCGTAGACGTAGTTTGACTATTCCTATACGTTTCTATTTA
TTGATGAGGATCCT
>Acinonyx_jubatus
ATGACCCACCAAACCCATGCATACCACATAGTTAACCCCAGCCCATGACCGCTTACAGGGGCCCTTTCAG
CCCTCCTTATAACCTCAGGCCTAGCTATATGATTTCACTATAACTCAACACTACTATTAACCCTTGGAAT
AACTACTAATCTATTAACAATATATCAATGATGACGAGACATCGTTCGAGAAAGCACATTTCAAGGCCAT
CATACGCCCATCGTTCAAAAAGGCCTCCGATATGGAATAATCCTCTTTATCGTCTCAGAAGTATTCTTTT
TTGCAGGCTTCTTCTGGGCCTTTTACCACTCAAGCCTAGCCCCAACCCCCGAACTAGGAGGATGCTGACC
ACCAACAGGCATTATTCCCCTAAACCCCTTAGAAGTTCCACTACTTAATACTTCAGTTCTTCTAGCCTCT
GGAGTATCTATCACCTGAGCTCACCATAGCCTAATAGAAGGAAACCGAAAACACATGCTCCAAGCACTAC
TCATTACAATCTCCCTAGGAGTCTATTTTACACTCCTCCAAGCCTCCGAATATTACGAAACACCATTTAC
GATCTCAGATGGGATTTACGGATCCACCTTCTTTATAGCTACAGGATTCCACGGACTACATGTAATTATT
GGTTCCACCTTCCTAATTGTATGCTTCTTACGCCAATTAAAATATCACTTTACATCAAATCATCATTTCG
GGTTCGAAGCCGCTGCTTGATATTGACATTTCGTAGATGTAGTTTGACTATTCTTATACGTTTCCATTTA
TTGATGAGGATCTT



Setelah mendapatkan gen tersebut, maka kita akan meng-aligment sekuen gen-gen tersebut secara online terlebih dahulu melalui situs dari EBI [klik di sini]. Selanjutnya pilih menu TOOLS > Sequence Analysis > ClustalW2 seperti pada gambar berikut:



Setelah itu akan muncul tanpilan seperti gambar berikut:



Paste kode gen DNA di atas ke Step 1 dan jangan lupa pilih menu “DNA” pada pilihan “Enter or paste a set of ... “. Selanjutnya untuk Step 2 dan Step 3 diabaikan saja dan kemudian klik SUBMIT dan tunggu sejenak maka akan muncul hasil alignment seperti gambar berikut:
 

Hasil tersebut merupakan proses alignment berbagai macam sekuens DNA dari organisme yang berbeda. Hasil tersebut menggambarkan bahwa ada sekuens yang sama pada setiap urutan yang ditandai dengan tanda bintang (*) sementara sekuens yang tidak terdapat tanda bintang berarti ada sekuens yang tidak sama.

Semoga Bermanfaat.

Subscribe to receive free email updates: